Telomere
A telomere is a region of highly repetitive DNA at the end of a chromosome, which functions as an aglet. Every time linear eukaryotic chromosomes are replicated, the DNA polymerase complex stops several hundred bases before the end; if it were not for telomeres, this would quickly result in the loss of useful genetic information. In prokaryotes, chromosomes are circular and thus do not have ends to suffer premature replication termination at. Only eukaryotes possess or require telomeres.
Telomeres are extended by telomerases, specialized reverse transcriptases that are involved in synthesis of telomeres in most organisms. Telomerases are very interesting DNA polymerasess in that they carry an RNA template for the telomere sequence within them.
In humans, the telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but are generally GC-rich.
In most multicellular eukaryotes, telomerase is only active in germ cells. There are theories that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions. These theories remain relatively controversial at this time.
Advocates of human life extension promote the idea of lengthening the telomeres in certain cells through gene therapy. They reason that this would extend human life. So far these ideas have not been proven.
| Group | Organism | Telomeric repeat (5' to 3' toward the end) |
|---|---|---|
| Vertebrates | Human, mouse, Xenopus | TTAGGG |
| Filamentous fungi | Neurospora | TTAGGG |
| Slime molds | Physarum, Didymium
Dictyostelium |
TTAGGG AG(1-8) |
| Kinetoplastids protozoa | Trypanosoma, Crithidia | TTAGGG |
| Ciliate protozoa | Tetrahymena, Glaucoma Paramecium Oxytricha, Stylonychia, Euplotes |
TTGGGG TTGGG(T/G) TTTTGGGG |
| Apicomplexan protozoa | Plasmodium | TTAGGG(T/C) |
| Higher plants | Arabidopsis | TTTAGGG |
| Algae | Chlamydomonas | TTTTAGGG |
| Insects | Bombyx mori | TTAGG |
| Roundworms | Ascaris lumbricoides | TTAGGC |
| Fission yeasts | Schizosaccharomyces pombe | TTAC(A)(C)G(1-8) |
| Budding yeasts |
Saccharomyces cerevisiae Candida glabrata Candida albicans Candida tropicalis Candida maltosa Candida guillermondii Candida pseudotropicalis Kluyveromyces lactis |
TGTGGGTGTGGTG (from RNA template) or G(2-3)(TG)(1-6)T (consensus) GGGGTCTGGGTGCTG GGTGTACGGATGTCTAACTTCTT GGTGTA[C/A]GGATGTCACGATCATT GGTGTACGGATGCAGACTCGCTT GGTGTAC GGTGTACGGATTTGATTAGTTATGT GGTGTACGGATTTGATTAGGTATGT |
